Sequence Alignment: Chimera Alignment

Hello everybody!

I was wondering how we could create a code doing chimeric alignment? For more information about chimeric alignment see here.

The above link is the only source for reading I found on the Internet as well. Some useful details I know about the problem are: Let a virus infect a bacterium and modifies a bacterium reduplication process adding:

• to each A(for adenine), a polyA having length from 1 to 5
• to each C(for cytosine), a polyC having length from 1 to 10
• to each G(for guanine), a polyG having random length >= 1
• to each T(for thymine), a polyT having random length >= 1

Also, no spaces or additions into the modified by the virus DNA are allowed. E.g. the sequence AAATAAAGGGGCCCCCTTTTTTTCC is the infected version of ATAGCTC.

I have studied some kinds of sequence alignments and I am studying now this kind of alignment. I have made some conclusions (using nwalign and swalign) but I would like to get some advice about this topic (or some guidelines).

I would appreciate any kind of help and I am looking forward to reading your answers!

Thank you in advance!