Binary to DNA sequence encoding - matlab

I am implementing DNA encryption algorithm.

For that, I have a vector containing binary values such as:

01100011 01110010 01111001 01110000 01110100 01101111.

Now, these values should be mapped to DNA sequence. How do I do that in MATLAB?

[Star Strider]

DNA has four bases (two complementary sets, A-T and C-G) and you have a binary sequence ...

[Meghashree G]

yeah..i know To use ATGC concept,but i don't know how to code..Like how do i extract only 2 digits from the binary vector and assign it to either A,T,G,C..

Answer 1

[Image Analyst]

Perhaps this:

% Assign sample data.
binaryArray = [0,1,1,0,0,0,1,1, 0,1,1,1,0,0,1,0, 0,1,1,1,1,0,0,1, 0,1,1,1,0,0,0,0, 0,1,1,1,0,1,0,0, 0,1,1,0,1,1,1,1];
% Define base letters to choose from.
bases = 'ATGC';
for k = 1 : 2 : length(binaryArray)
  % Convert these two digits into a number 1 - 4.
  index = 2 * binaryArray(k) + binaryArray(k+1) + 1;
  % Use that index to assign a letter to our result.
  result((k+1)/2) = bases(index);
end
% Display in command window:
result

It shows:

result =
TGACTCAGTCGTTCAATCTATGCC

[Meghashree G]

Thank you so much :) it worked :)

[Saurabh Kumar]

I want to create a function in Matlab of above solution you have given. So that I don't need to describe different binary Everytime in .m blank file format. Please help Function []=binary()

[Image Analyst]

function result = LabelBinaryArray(binaryArray)
% Define base letters to choose from.
bases = 'ATGC';
for k = 1 : 2 : length(binaryArray)
  % Convert these two digits into a number 1 - 4.
  index = 2 * binaryArray(k) + binaryArray(k+1) + 1;
  % Use that index to assign a letter to our result.
  result((k+1)/2) = bases(index);
end

[Saurabh Kumar]

Attempted to access binaryArray(2); index out of bounds because numel(binaryArray)=1.

Error in LabelBinaryArray (line 6) index = 2 * binaryArray(k) + binaryArray(k+1) + 1;

NOT WORKING

[Image Analyst]

It works if you pass in something like you said, like '01100011'. You can't pass in a single value like '1' like you did because that can't be mapped to a letter. How do I know you passed in only a single element? Because the error message says "because numel(binaryArray)=1" Are you sure you're passing in a binary array like you said? I'm assuming a binary array, which is class logical, though a double will work. You aren't passing in a string are you? Show me how you defined the array you passed in to the function.

[Saurabh Kumar]

 LabelBinaryArray('011000110111001001111001011100000111010001101111')
Attempted to access bases(146); index out of bounds because numel(bases)=4.

Error in LabelBinaryArray (line 8) result((k+1)/2) = bases(index);

[Image Analyst]

OK, you have a string, not a binary/logical array. To convert to a binary array you need to do this:

str = '011000110111001001111001011100000111010001101111'
binaryArray = logical(str - '0')

You can do that either inside the function, if you want to pass a string, or in your main program before you call the function, if you want to pass a binary array.

[Saurabh Kumar]

it worked. THANKS

[Saravanakumar Chandrasekaran]

How to decrypt it back to binary sequence

[Image Analyst]

Decrypt what back to a binary sequence. You have the binary sequence both as a character array, str, and a logical/boolean array, binaryArray. What else do you want? What's missing? Just keep both things and you're all set.

[Shiva Reddy]

Pls Can I get the decryption code

[Image Analyst]

Shiva, I'm not sure who you're asking, but personally I don't have any to give you.