localalign

Return local optimal and suboptimal alignments between two sequences

Syntax

AlignStruct = localalign(Seq1,Seq2)

AlignStruct = localalign(Seq1,Seq2,Name=Value)

Description

AlignStruct = localalign(Seq1,Seq2) returns information about the first optimal (highest scoring) local alignment between two sequences in a MATLAB^® structure.

AlignStruct = localalign(Seq1,Seq2,Name=Value) specifies options using one or more name-value arguments in addition to the arguments in previous syntaxes.

Examples

Number of Alignments

Limit the number of alignments to return between two sequences by specifying the number of alignments.

Create variables containing two amino acid sequences.

Seq1 = "VSPAGMASGYDPGKA";
Seq2 = "IPGKATREYDVSPAG";

Use the NumAln argument to return information about the top three local alignments.

struct1 = localalign(Seq1,Seq2,NumAln=3)

struct1 = struct with fields:
        Score: [3×1 double]
        Start: [3×2 double]
         Stop: [3×2 double]
    Alignment: {3×1 cell}

View the scores of the first and second alignments.

struct1.Score(1:2)

ans = 2×1

   11.0000
    9.6667

View the first alignment.

struct1.Alignment{1}

ans = 3×5 char array
    'VSPAG'
    '|||||'
    'VSPAG'

Minimum Score

Limit the number of alignments to return between two sequences by specifying a minimum score.

Create variables containing two amino acid sequences.

Seq1 = "VSPAGMASGYDPGKA";
Seq2 = "IPGKATREYDVSPAG";

Use MinScore to return information about only local alignments with a score greater than 8. Use DoAlignment to exclude the actual alignments.

struct2 = localalign(Seq1,Seq2,MinScore=8,DoAlignment=false)

struct2 = struct with fields:
    Score: [2×1 double]
    Start: [2×2 double]
     Stop: [2×2 double]

Percentage of Highest Score

Limit the number of alignments to return between two sequences by specifying a percentage of the highest score.

Create variables containing two amino acid sequences.

Seq1 = "VSPAGMASGYDPGKA";
Seq2 = "IPGKATREYDVSPAG";

Use Percent to return information about only local alignments with a score within 15% of the maximum score.

struct3 = localalign(Seq1,Seq2,Percent=15)

struct3 = struct with fields:
        Score: [2×1 double]
        Start: [2×2 double]
         Stop: [2×2 double]
    Alignment: {2×1 cell}

Gap Opening Penalty

Specify a scoring matrix and gap opening penalty when aligning two sequences.

Create variables containing two nucleotide sequences.

Seq1 = "CCAATCTACTACTGCTTGCAGTAC";
Seq2 = "AGTCCGAGGGCTACTCTACTGAAC";

Create a scoring matrix with a match score of 10 and a mismatch score of -9.

sm = [10 -9 -9 -9;
      -9 10 -9 -9;
      -9 -9 10 -9;
      -9 -9 -9 10];

Use ScoringMatrix and GapOpen when returning information about the top three local alignments.

struct4 = localalign(Seq1,Seq2, ...
                     Alphabet="nt", ...
                     ScoringMatrix=sm, ...
                     GapOpen=20, ...
                     NumAln=3)

struct4 = struct with fields:
        Score: [3×1 double]
        Start: [3×2 double]
         Stop: [3×2 double]
    Alignment: {3×1 cell}

Input Arguments

Seq1 — First amino acid or nucleotide sequence

string | character vector | vector of integers | structure array

First amino acid or nucleotide sequence, specified as one of these values:

• Character vector or string of letters representing amino acids or nucleotides, such as returned by int2aa or int2nt

• Vector of integers representing amino acids or nucleotides, such as returned by aa2int or nt2int

• MATLAB structure array containing a Sequence field, such as returned by fastaread, fastqread, emblread, getembl, genbankread, getgenbank, getgenpept, genpeptread, getpdb, pdbread, or sffread

For help with letter and integer representations of amino acids and nucleotides, see Amino Acid Lookup or Nucleotide Lookup.

Data Types: double | char | string | struct

Seq2 — Second amino acid or nucleotide sequence

string | character vector | vector of integers | structure array

Second amino acid or nucleotide sequence, specified as one of these values:

• Character vector or string of letters representing amino acids or nucleotides, such as returned by int2aa or int2nt

• Vector of integers representing amino acids or nucleotides, such as returned by aa2int or nt2int

• MATLAB structure array containing a Sequence field, such as returned by fastaread, fastqread, emblread, getembl, genbankread, getgenbank, getgenpept, genpeptread, getpdb, pdbread, or sffread

For help with letter and integer representations of amino acids and nucleotides, see Amino Acid Lookup or Nucleotide Lookup.

Data Types: double | char | string | struct

Name-Value Arguments

Specify optional pairs of arguments as Name1=Value1,...,NameN=ValueN, where Name is the argument name and Value is the corresponding value. Name-value arguments must appear after other arguments, but the order of the pairs does not matter.

Example: NumAln=3

NumAln — Number of alignments to return

1 (default) | positive number

Number of alignments to return, specified as a positive number not exceeding 2¹². The localalign functions returns the top NumAln local, nonintersecting alignments (optimal and suboptimal). If the number of optimal alignments is greater than the specified number of alignments, then localalign returns the first NumAln alignments based on their order in the trace back matrix.

Use NumAln to return multiple alignments when you are aligning low complexity sequences and must consider several local alignments.

Note

You cannot combine NumAln with MinScore or Percent.

Data Types: double

MinScore — Minimum score of alignments to return

positive number

Minimum score of local, nonintersecting alignments (optimal and suboptimal) to return, specified as a positive number. Use MinScore to return suboptimal alignments, for example when you are interested in accounting for sequencing errors or imperfect scoring matrices.

Note

You cannot combine MinScore with NumAln or Percent.

Data Types: double

Percent — Percent of highest score

positive number between 0 and 100

Percent of the highest score, specified as a positive number between 0 and 100. This value limits the return of local, nonintersecting alignments (optimal and suboptimal) to those alignments with a score within the specified percentage of the highest score. For example, if the highest score is 10.5 and you specify 5, then localalign determines a minimum score of 10.5 – (10.5 * 0.05) = 9.975. It returns all alignments with a score of 9.975 or higher.

Use Percent to return optimal and suboptimal alignments when you do not know how similar the two sequences are or how well they score against a given scoring matrix.

Note

You cannot combine Percent with NumAln or MinScore.

Data Types: double

DoAlignment — Indicator to include pairwise alignments

true (default) | false

Indicator to include the pairwise alignments in the Alignment field of the output structure array, specified as true or false.

Data Types: logical

Alphabet — Type of sequences

"AA" (default) | "NT"

Type of sequences, specified as "AA" or "NT".

Data Types: char | string

ScoringMatrix — Scoring matrix to use for local alignment

string | character vector | matrix

Scoring matrix to use for local alignment, specified as one of these values for amino acid sequences:

• A string or a corresponding character vector:

  • "BLOSUM62"

  • "BLOSUM30" increasing by 5 up to "BLOSUM90"

  • "BLOSUM100"

  • "PAM10" increasing by 10 up to "PAM500"

  • "DAYHOFF"

  • "GONNET"

  The default values are:

  • "BLOSUM50" — If Alphabet is set to "AA".

  • "NUC44" — If Alphabet is set to "NT".

  The previous scoring matrices, provided with the software, also include a structure containing a scale factor that converts the units of the output score to bits. You can also use the Scale argument to specify an additional scale factor to convert the output score from bits to another unit.

• A matrix representing the scoring matrix to use for the local alignment, such as returned by the blosum, pam, dayhoff, gonnet, or nuc44 function.

  If you use a scoring matrix that you created or was created by one of the previous functions, the matrix does not include a scale factor. The output score is returned in the same units as the scoring matrix. You can use the Scale argument to specify a scale factor to convert the output score to another unit.

If you need to compile localalign into a stand-alone application or software component using MATLAB Compiler™, use a matrix instead of a character vector or string for ScoringMatrix.

Data Types: char | string

Scale — Scale factor applied to output scores

1 (default) | positive number

Scale factor applied to the output scores, thereby controlling the units of the output scores, specified as a positive number. For example, if the output score is initially determined in bits, and you specify the scale factor log(2), then localalign returns Score in nats. The default value 1 does not change the units of the output score.

If the ScoringMatrix argument also specifies a scale factor, then localalign uses it first to scale the output score. It then applies the scale factor specified by Scale to rescale the output score.

Before comparing alignment scores from multiple alignments, ensure that the scores are in the same units. Use Scale to control the units of the output scores.

Data Types: double

GapOpen — Penalty for opening gap in alignment

8 (default) | positive number

Penalty for opening a gap in the alignment, specified as a positive number.

Data Types: double

Output Arguments

AlignStruct — Information about local optimal and suboptimal alignments between two sequences

structure array | array of structure arrays

Information about the local optimal and suboptimal alignments between two sequences, returned as a MATLAB structure array or array of structure arrays. Each structure array represents an optimal or suboptimal alignment and contains these fields.

Field	Description
Score	Score for the local optimal or suboptimal alignment.
Start	1-by-2 vector of indices indicating the starting point in each sequence for the alignment.
Stop	1-by-2 vector of indices indicating the stopping point in each sequence for the alignment.
Alignment	3-by-N character array showing the two sequences, Seq1 and Seq2, in the first and third rows. It also shows symbols representing the optimal or suboptimal local alignment between the two sequences in the second row.

More About

Nonintersecting Alignments

Alignments having no matches or mismatches in common.

Optimal Alignment

An alignment with the highest score.

Suboptimal Alignment

An alignment with a score less than the highest score.

References

[1] Barton, G. (1993). An efficient algorithm to locate all locally optimal alignments between two sequences allowing for gaps. CABIOS 9, 729–734.

Version History

Introduced in R2009b