dna2rna

Convert DNA sequence to RNA sequence

Syntax

SeqRNA = dna2rna(SeqDNA)


Arguments

SeqDNA

DNA sequence specified by any of the following: Character vector or string with the characters A, C, G, T, and ambiguous characters R, Y, K, M, S, W, B, D, H, V, N, Row vector of integers from the table Mapping Nucleotide Integers to Letter Codes. MATLAB® structure containing a Sequence field that contains a DNA sequence, such as returned by fastaread, fastqread, emblread, getembl, genbankread, or getgenbank.

Description

SeqRNA = dna2rna(SeqDNA) converts a DNA sequence to an RNA sequence by converting any thymine nucleotides (T) in the DNA sequence to uracil nucleotides (U). The RNA sequence is returned in the same format as the DNA sequence. For example, if SeqDNA is a vector of integers, then so is SeqRNA.

Examples

Convert a DNA sequence to an RNA sequence

dna = randseq(100)

dna = 
'TTATGACGTTATTCTACTTTGATTGTGCGAGACAATGCTACCTTACCGGTCGGAACTCGATCGGTTGAACTCTATCACGCCTGGTCTTCGAAGTTAGCAC'

rna = dna2rna(dna)

rna = 
'UUAUGACGUUAUUCUACUUUGAUUGUGCGAGACAAUGCUACCUUACCGGUCGGAACUCGAUCGGUUGAACUCUAUCACGCCUGGUCUUCGAAGUUAGCAC'

Version History

Introduced before R2006a