palindromes

Find palindromes in sequence

Syntax

[Position,Length] = palindromes(SeqNT)

[Position,Length,Pal] = palindromes(SeqNT)

___ = palindromes(SeqNT,Name=Value)

Description

[Position,Length] = palindromes(SeqNT) finds all palindromes in sequence SeqNT with a length greater than or equal to 6, and returns the starting indices, Position, and the lengths of the palindromes, Length.

[Position,Length,Pal] = palindromes(SeqNT) also returns a cell array of the palindromes.

___ = palindromes(SeqNT,Name=Value) specifies options using one or more name-value arguments in addition to the arguments in previous syntaxes.

Examples

Palindromes in Simple Nucleotide Sequence

Find the palindromes in a simple nucleotide sequence.

[p,l,s] = palindromes("GCTAGTAACGTATATATAAT") 

p = 2×1

    11
    12

l = 2×1

     7
     7

s = 2×1 cell
    {'TATATAT'}
    {'ATATATA'}

Complementary Palindromes in Simple Nucleotide Sequence

Find the complementary palindromes in a simple nucleotide sequence.

[pc,lc,sc] = ...
    palindromes("TAGCTTGTCACTGAGGCCA", ...
                Complement=true)

pc = 
8

lc = 
7

sc = 1×1 cell array
    {'TCACTGA'}

Palindromes in Random Nucleotide Sequence

Generate a random nucleotide sequence.

a = randseq(100)

a = 
'GGCGCATTCAGATGTGTTGCCTATGCTGATATCATAGAAATTTTTTTATACGATAAAGCTTCTGACAATCATTATCTTACGCTTGACCGGTACGGATCAA'

Find the palindromes in this sequence.

[pos,len,pal] = palindromes(a)

pos = 3×1

    40
    41
    42

len = 3×1

    9
    6
    6

pal = 3×1 cell array
    "'ATTTTTTTA'"
    "'TTTTTT'"
    "'TTTTTT'"

Input Arguments

SeqNT — Sequence

string | 0 | character vector | row vector of integers | structure array

Sequence, specified as one of these values:

• Character vector or string specifying a nucleotide sequence. For valid letter codes, see the table Mapping Nucleotide Letter Codes to Integers.

• Row vector of integers specifying a nucleotide sequence. For valid integers, see the table Mapping Nucleotide Integers to Letter Codes.

• MATLAB^® structure containing a Sequence field that contains a nucleotide sequence, such as returned by emblread, fastaread, fastqread, genbankread, getembl, or getgenbank.

Data Types: double | char | string | struct

Name-Value Arguments

Specify optional pairs of arguments as Name1=Value1,...,NameN=ValueN, where Name is the argument name and Value is the corresponding value. Name-value arguments must appear after other arguments, but the order of the pairs does not matter.

Example: Complement=true

Length — Minimum length for palindromes

6 (default) | integer

Minimum length for palindromes, specified as an integer.

Data Types: double

Complement — Indicator to return complementary palindromes

false (default) | true

Indicator to return complementary palindromes, specified as true or false. Complementary palindromes are palindromes whose elements match their complementary pairs A-T (or U) and C-G instead of an exact nucleotide match.

Data Types: logical

Output Arguments

Position — Starting indices

integers

Starting indices, returned as integers.

Length — Lengths of palindromes

integers

Lengths of the palindromes, returned as integers.

Pal — Array of palindromes

cell array

Array of the palindromes, returned as a cell array.

Version History

Introduced before R2006a