getInfo
R2026bRetrieve information for single element of BioMap object
Syntax
Info = getInfo(BioObj, Element)
Description
returns Info = getInfo(BioObj, Element)Info,
a tab-delimited character vector containing information about a single
element in BioObj, a BioMap object.
Input Arguments
| Object of the |
| One of the following to specify one element in
|
Output Arguments
| Tab-delimited character vector containing information about
a single element in
|
Examples
Construct a BioMap object, and then retrieve
information for the second element in the object:
% Construct a BioMap object from a SAM file
BMObj1 = BioMap('ex1.sam');
% Retrieve information for the second element in the object
element2Info = getInfo(BMObj1, 2)element2Info = EAS54_65:7:152:368:113 73 3 99 35M CTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGT <<<<<<<<<<0<<<<655<<7<<<:9<<3/:<6):